haplogroup g originque significa cuando se cae una cuchara al piso
Peter A Underhill. It remains to be seen if testing will reveal G-M377 haplotypes in other populations this is some indication that G-M377 occurs at low levels in the Near East. Haplogroup | Your past through your genes Here we address this issue with a phylogeographic overview of the distribution of informative G sub-clades from South/Mediterranean Europe, Near/Middle East, the Caucasus and Central/South Asia. Karafet TM, Mendez FL, Meilerman MB, Underhill PA, Zegura SL, Hammer MF : New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree. Gurdeep Matharu Lall, Maarten H. D. Larmuseau, Mark A. Jobling, Hovhannes Sahakyan, Ashot Margaryan, Richard Villems, Javier Rodriguez Luis, Leire Palencia-Madrid, Rene J. Herrera, Sandra Oliveira, Alexander Hbner, Jorge Rocha, Alessandra Modi, Desislava Nesheva, David Caramelli, Maxat Zhabagin, Zhaxylyk Sabitov, Elena Balanovska, Veronika Csky, Dniel Gerber, Anna Szcsnyi-Nagy, European Journal of Human Genetics Name: G-L14 Age: 7800 ybp 1700 CI 95% Expansion: 5200 ybp 1900 CI 95% Parent: G-L1 Note: This information does not imply an endorcement of YFull or their methods. [41] These classifications are based on shared SNP mutations. Similarly, G-P16 and G-M377 networks were created using 104 P16-derived 19-locus haplotypes and 61G-M377-derived 9-locus haplotypes, with both groups representing European, Near/Middle Eastern and central/west Asian populations. In 2009-10, Family Tree DNA's Walk through the Y Project, sequencing certain Y-chromosome segments, provided a number of new G SNPs with the L designation. To obtain ), Haplogroup M, as of 2017, is also known as K2b1b. A majority of members of G-P303 belong to one of its subclades, rather than to G-P303*, The largest G-P303* subclade based on available samples is one in which almost all persons have the value of 13 at STR marker DYS388. In addition, K-Y28299, which appears to be a primary branch of K-M2313, has been found in three living individuals from India. Elizabeth T Wood, Daryn A Stover, Christopher Ehret, L177, later discarded in favour of PF3359 and equivalent SNPs, was first identified at. Although no basal G-M201* chromosomes were detected in our data set, the homeland of this haplogroup has been estimated to be somewhere nearby eastern Anatolia, Armenia or western Iran, the only areas characterized by the co-presence of deep basal branches as well as the occurrence of high sub-haplogroup diversity. MH and MHS are thankful to the National Institute for Genetic Engineering and Biotechnology, Tehran, Iran, and the National Research Institute for Science policy, Tehran, Iran, for providing the samples. Pericic M, Lauc LB, Klaric IM, Janicijevic B, Rudan P : Review of croatian genetic heritage as revealed by mitochondrial DNA and Y chromosomal lineages. Kaniewski D, Van Campo E, Van Lerberghe K et al. Principal component analysis based on G sub-haplogroup frequencies was performed using the freeware POPSTR program (http://harpending.humanevo.utah.edu/popstr/). Haplogroup H dominates present-day Western European mitochondrial DNA variability (>40%), yet was less common (~19%) among Early Neolithic farmers (~5450 BC) and virtually absent in Mesolithic . Nasidze I, Quinque D, Dupanloup I et al. [2][37], Ancient DNA identified as G-PF3359 has been found at archaeological sites in: Hungary (the subclade G-F872*), dated at 7,500 years before present (BP); Hungary (subclade G-F1193*) 7,150 BP, and; Spain (G-PF3359*) 4,700 BP.[2]. The Morans I coefficient was calculated using the PASSAGE software v.1.1 (Phoenix, AZ, USA) with binary weight matrix, nine distance classes and random distribution assumption. In the ten remaining populations, haplogroup diversity spanned from a low of 0.21 in Adyghes, to highs of 0.88 in Azeris (Iran) and 0.89 in eastern Anatolia and 0.90 in Armenia. The highest frequency values for P303 are detected in populations from Caucasus region, being especially high among South Caucasian Abkhazians (24%) and among Northwest (NW) Caucasian Adyghe and Cherkessians39.7% and 36.5%, respectively. Thus, G2a3a-M406, along with other lineages, such as J2a3b1-M92 and J2a4h2-DYS445=616, may track the expansion of the Neolithic from Central/Mediterranean Anatolia to Greece/Italy and Iran. Although the present-day frequency of G1 is low across its spread zone, the expansion time estimate (Supplementary Table S4) of 192716158 years attests to considerable antiquity. The Levant versus the Horn of Africa: evidence for bidirectional corridors of human migrations. Also for P15* and L91 lineages Td estimates, DYS19 was excluded owing to duplications in these lineages.36. Y chromosomal heritage of Croatian population and its island isolates. Eur J Hum Genet 2008; 16: 374386. The Madjar and Argyn tribes (or clans) of Kazakhstan were found to possess the highest levels of G-M201 among any modern ethnic group. Herein . The frequency pattern and the microsatellite network of E-M2(xM191) indicate a West African origin followed by expansion, a result that is in agreement with the findings of Cruciani et al. This value of 12 is uncommon in other G categories other than G1. Haplogroup definition, a set of similar haplotypes inherited together, or a group who shares a set of similar haplotypes, used to understand genetic lineages. There are additional subclades of DYS388=13 men characterized by the presence of specific SNPs or uncommon STR marker oddities. [Origin of European 3/6] First Farmer of Europe and Y-DNA Haplogroup G The genome-wide structure of the Jewish people. Nonetheless, our approach using high-resolution phylogenetic relationships as well as their phylogeography to infer the possible origin of a genetic variant provides a more plausible deduction than simply the region of highest frequency. [42] The technical specifications of M201 are given as: refSNPid is rs2032636..Y chromosome location of 13536923.forward primer is tatgcatttgttgagtatatgtc..reverse primer is gttctgaatgaaagttcaaacg..the mutation involves a change from G to T. A number of SNPs have been identified with seemingly the same coverage in the population as M201. [23] About 6% of the samples from Sri Lanka and Malaysia were reported as haplogroup G, but none were found in the other coastal lands of the Indian Ocean or Pacific Ocean in Asia. Am J Hum Genet 2001; 68: 10191029. The emergence of Y-chromosome haplogroup J1e among Arabic-speaking populations. The G-L13 subclade is most common in north central Europe, and G-Z1266 is most common in the western Caucasus Mountains. Capelli C, Brisighelli F, Scarnicci F, Blanco-Verea A, Brion M, Pascali VL : Phylogenetic evidence for multiple independent duplication events at the DYS19 locus. G-L13/S13 (Y-DNA) - geni family tree In human genetics, Haplogroup G-P303 ( G2a2b2a, [2] formerly G2a3b1) is a Y-chromosome haplogroup. The members of G-PF3359 are probably smaller in number than men included in G-P303, but only a small amount of testing has occurred for the relevant mutations. PLoS One 2011; 6: e20232. Haplogroup A0-T is also known as A-L1085 (and previously as A0'1'2'3'4). Genetic evidence concerning the origins of South and North Ossetians. Looking still more closely at the distribution of P303 sub-clades, some distinct patterns emerge in the network (Figure 4). The L141 mutation is found on the Y chromosome at 2948607. Haplogroup G-M201 - Wikipedia Unresolved G2a-P15* lineages occur across a wide area extending from the Near/Middle East to the Balkans and Western Europe in the west, the Caucasus (especially the South Caucasus) in the north and Pakistan in the east. The origin of haplogroup G is controversial. However, interpretations based on simple haplogroup frequency clines do not recognize underlying patterns of genetic diversification. Flores C, Maca-Meyer N, Gonzalez AM et al. Semino O, Magri C, Benuzzi G et al. The G2 clade consists of one widespread but relatively infrequent collection of P287*, M377, M286 and M287 chromosomes versus a more abundant assemblage consisting of G2a-related P15*, P16 and M485-related lineages. The following SNPs are so far identified as M201 equivalents: L116, L154, L269, L294, L240, P257, L402, L520, L521, L522, L523, L605, Page 94, U2, U3, U6, U7, U12, U17, U20, U21, U23 and U33. G-PF3147 (previously G-L223 and G-PF3146) is characterized by having the L223 mutation. This is achieved by comparing the haplotypes through the STR markers. Haplogroup Definition & Meaning | Dictionary.com G-M377, now also known as G2b1, has previously been designated G2b and G2c. Important caveats to consider include the fact that Td is sensitive to authentic rare outlier alleles and that multiple founders during population formation will inflate the age estimate of the event. Parent Branch: G-FGC5081 Descendant branch(s): G-Z17084 G-Z45043 FTDNA Tree Link: Link YFull Info. Hum Genet 2009; 126: 707717. The Caucasus as an asymmetric semipermeable barrier to ancient human migrations. Am J Hum Genet 2004; 74: 694704. Ann Hum Genet 2004; 68: 588599. Men who belong to this group but are negative for all its subclades represent a small number today. We attempted to localize the potential geographic origin of . Its estimated Td of 120953000 years ago suggests considerable antiquity allowing time to accumulate STR diversity and also to disperse relatively widely. (a)(f) Spatial frequency maps of haplogroup G (hg G) and its sub-clades with frequencies over 10%. In the meantime, to ensure continued support, we are displaying the site without styles [26][27] Among the Druze mostly residents of Israel 10% were found to be haplogroup G.[28], Around 10% of Jewish males are Haplogroup G.[citation needed], In Africa, haplogroup G is rarely found in sub-Saharan Africa or south of the horn of Africa among native populations. Haplogroup S, as of 2017, is also known as K2b1a. The hg G2a3b1c-L497 sub-cluster, on the other hand, has so far been found essentially in European populations and therefore is probably autochthonous to Europe. G2a2b1 so far has seldom surfaced in northern Africa or southern Asia, but represents a small percentage of the G population in the Caucasus Mountains region and in Iran. Capelli C, Brisighelli F, Scarnicci F et al. Although not exceeding 3% frequency overall, haplogroup G1-M285 reflects a branching event that is phylogenetically equivalent to the more widespread companion G2-P287 branch in the sense that both branches coalesce directly to the root of G-M201. Semino O, Passarino G, Oefner PJ et al. The coalescent times (Td) of various haplogroups were estimated using the ASDo methodology described by Zhivotovsky et al,32 modified according to Sengupta et al.13 We used the evolutionary effective mutation rate of 6.9 104 per 25 years, as pedigree rates are arguably only pertinent to shallow rooted familial pedigrees,33 as they do not consider the evolutionary consequences of population dynamics including the rapid extinction of newly appearing microsatellite alleles. (2000) suggested 17,000 years ago. Extended Y chromosome haplotypes resolve multiple and unique lineages of the Jewish priesthood. Haplogroup G (Y-DNA) In human genetics, Haplogroup G (M201) is a Y-chromosome haplogroup. The network was obtained using the biallelic markers P303, M426, L497, U1, M527 and 19 STR loci (DYS19, DYS388, DYS389I, DYS389b, DYS390, DYS391, DYS392, DYS393, DYS439, DYS461 (TAGA counts), DYS385a,b, DYS437, DYS438, DYS448, DYS456, DYS458, DYS635, YGATAH4). [5] Cinnioglu et al. G-P16 has a high frequency in South and NW Caucasus, with the highest frequency among North Ossetians63.6%. P257 was first reported in 2008. and JavaScript. [16] The concentration of G falls below this average in Scandinavia, the westernmost former Soviet republics and Poland, as well as in Iceland and the British Isles. Article Haplogroup - an overview | ScienceDirect Topics Y-DNA Haplogroup G-M201 - Marres Haplogroup G was the first branch of Haplogroup F outside of Africa. [21] In a study of 936 Indians, haplogroup G made up less than 1% of the sample and was completely absent in the tested Northwestern Indian population. G-P303*, also known as G2a2b2a* (previously G2a3b1*), and its subclades are now concentrated in southern Russia and the Caucasus, as well as, at lower levels, other parts of Europe and South West Asia, especially an area including Turkey, Iran and the Middle East where G2a2b2a may have originated. Correspondence to Am J Hum Genet 2004; 74: 788788. SD was also calculated for the age estimates according to the following formula: 25/1000 (ASD0 variance)/0.00069. The fragments were run on the ABI PRISM 3130xl Genetic Analyzer (Applied Biosystems). They arewith accompanying Y-chromosome locationsU5 (rs2178500), L149 (8486380) and L31 (also called S149) (rs35617575..12538148). (a) Principal component analysis by population. Pichler I, Fuchsberger C, Platzer C et al. Am J Hum Genet 2012; 90: 573. The National Geographic Society places haplogroup G origins in the Middle East 30,000 years ago and presumes that people carrying the haplogroup took part in the spread of the Neolithic Two scholarly papers have also suggested an origin in the Middle East, while differing on the date. Its age is between 7,700 and . N-mtDNA - Background | FamilyTreeDNA Drawing the history of the Hutterite population on a genetic landscape: inference from Y-chromosome and mtDNA genotypes. White PS, Tatum OL, Deaven LL, Longmire JL : New, male-specific microsatellite markers from the human Y chromosome. The naming of sub-clades is according to YCC nomenclature principles. Goncalves R, Freitas A, Branco M et al. Mol Biol Evol 2006; 23: 22682270. The SNP L497 encompasses these men, but most G-L497 men belong to its subclade G-Z725, also known as G-DYS388=13. Armenian DNA Project - News | FamilyTreeDNA Parallel evolution of genes and languages in the Caucasus region. Balanovsky O, Rootsi S, Pshenichnov A et al. Haplogroup G men who belong to this group, but are negative for all G2a subclades, are uncommon in Europe but may represent a sizeable group in so far poorly tested areas east of Turkey. Vernesi C, Caramelli D, Dupanloup I et al. G2a2b2a is also found in India. The highest frequencies of haplogroup G appear in the Caucasus region; however it also shows significant frequencies in the Mediterranean areas and the Middle East [69,70]. In the Tirol (Tyrol) of western Austria, the percentage of G-M201 can reach 40% or more; perhaps the most famous example is the ancient remains of the so-called "Iceman", tzi. Its members include "tzi",[citation needed] the so-called Iceman, who died at least 5,000 years BP in the European Alps. The highest reported concentration of G1 and its subclades in a single country is in Iran, with next most frequent concentrations in neighboring countries to the west. While neither knowledge of paleo-climate, archeology or genetic evidence from a single locus using modern populations provides an unimpeachable microcosm of pre-historical expansions, considering them together cautiously provides a contextual framework for discussion. Evaluation of Y-chromosomal STRs: a multicenter study. Sims LM, Garvey D, Ballantyne J : Improved resolution haplogroup G phylogeny in the Y chromosome, revealed by a set of newly characterized SNPs. Network of 248 samples P303 derived from Supplementary Table S3. PubMed Origin. [36], G-PF3359 (or G2a2b2b; previously G2a3b2) was known prior to 2013 as G-L177. In Turkey, the South Caucasus and Iran, haplogroup G reaches the highest percentage of national populations. Eur J Hum Genet 2010; 18: 463470. The L141 mutation involves an insertion.[35]. Although M527 frequency (Supplementary Table S1) is relatively low (16%), its phylogeographic distribution in regions such as southern Italy, Ukraine and the Levant (Druze and Palestinians) often coincides with areas associated with the Neolithic and post-Neolithic expansions into the Greek Aegean beginning approximately 7000 years ago.41 The expansion time (Td) of M527 is 71002300 years ago and is consistent with a Middle to Late Neolithic expansion of M527 in the Aegean. Spatial frequency maps for sub-clades (panels bf) were obtained by applying the frequencies from Supplementary Table S1 using the Surfer software (version 8, Golden Software, Inc.), following the kriging algorithm with option to use bodies of water as breaklines. Although both broadly distributed, G2a-P15* and its downstream L91 sub-lineage have low frequencies, with the exception of Sardinia and Corsica. The most detailed SNP mutation identified was S126 (L30), which defines G2a3.[11]. There are multiple SNPs which so far have the same coverage as P15. The G-M286 subclade (M286+) is small compared with G-L91. ASD0 is the average squared difference in the number of repeats between all current chromosomes of a sample and the founder haplotype, which is estimated as the median of current haplotypes. Y-chromosomal evidence of the cultural diffusion of agriculture in Southeast Europe. The forward primer is GTATTGAACTTACAATTCACGTCCC, and the reverse is CTCTCCAAATCGGGTTTCCT. 25 and 0.00069 denote the assumed average generation time in years and the effective mutation rate, respectively, and 1000 is used to convert the result of the equation (into thousands of years). Please help update this article to reflect recent events or newly available information. Origins and history of European Y-DNA and mtDNA haplogroups But unusual values or unusual value combinations found at short tandem repeat markers (STRs) can also provide the basis of additional taxonomisation. While it is found in percentages higher than 10% among the Bakhtiari, Talysh people, Gilaki, Mazandarani and Iranian Azeris, it is closer to 5% among the Iranian Arabs and in some large cities. The British samples have inconsistent double values for STR marker DYS19 in many cases. Nat Commun 2012; 3. de Knijff P, Kayser M, Caglia A et al. The genetic legacy of Paleolithic Homo sapiens sapiens in extant Europeans: a Y chromosome perspective. Haplogroup G, together with J2 clades, has been associated with the spread of agriculture, especially in the European context. (Previously the name Haplogroup M was assigned to K2b1d. [citation needed] Here we present the haplogroup frequency distribution and STR variation of 16 informative G sub-clades by evaluating 1472 haplogroup G chromosomes belonging to 98 populations ranging from Europe to Pakistan. This is not surprising, as clines are not expected in cases of sharp changes in haplogroup frequency over a relatively small distance such as those observed for hg G, for instance between the Caucasus and Eastern Europe. Furthermore, the U1-specific sub-clade M527 is most pronounced among Ukrainians and Anatolian Greeks. [15] Among the samples in the YHRD database from the southern Caucasus countries, 29% of the samples from Abazinia, 31% from Georgia, 2% from Azerbaijan and 18% from Armenia appear to be G samples. The results were analyzed using the ABI PRISM program GeneMapper 4.0 (Applied Biosystems). There were only a few G categories until 2008 when major revisions to categories were made. Excavating Y-chromosome haplotype strata in Anatolia. suggested that: "We estimate that the geographic origin of haplogroup G plausibly locates somewhere nearby eastern Anatolia, Armenia or western Iran. Dulik MC, Osipova LP, Schurr TG : Y-chromosome variation in Altaian Kazakhs reveals a common paternal gene pool for Kazakhs and the influence of Mongolian expansions. G2a was found also in 20 out of 22 samples of ancient Y-DNA from Treilles, the type-site of a Late Neolithic group of farmers in the South of France, dated to about 5000 years ago. Zhivotovsky LA, Underhill PA, Cinnioglu C et al. The Caucasus are today mainly the countries of Georgia, Armenia, Azerbaijan and southwestern Russia. Semino O, Magri C, Benuzzi G, Lin AA, Al-Zahery N, et al. Haplogroup G (M201) is a human Y-chromosome haplogroup. G-M201 is most commonly found among various ethnic groups of the Caucasus, but is also widely distributed at low frequencies among ethnic groups throughout Europe, South Asia, Central Asia, and North Africa. Mol Phylogenet Evol 2007; 44: 228239. Neolithic mitochondrial haplogroup H genomes and the genetic - Nature The coalescence age estimate of 9400 years for P16 coincides with the early Holocene (Supplementary Table S4).